Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14475A1
Clone ID IST14475A1
Vector VICTR74
Project tigm

Sequence tag IST14475A1HMR1
Sequence
ATTAAGGATGGTTGTGAGCCNCCATGTGGTTGCTGGGAACTGAACTCAGGACCTTTGGAAGAACAGTCAGTGCTCTTAAC
CGCTGANCCNTCTCTCCAGCCCCCGAATACCTAGGTTTTAATTTCAGCTTTGCATTTATTACTGCAGGAACCATGGTTGC
TAAATTGCTCTTGCCTTGTTAGGTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI22336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65534961..65535162 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040652 (Oaz2) NP_035082 ornithine decarboxylase antizyme 2 Gene [Source:MGI Symbol;Acc:MGI:109492]

 
Come back to gene ENSMUSG00000040652


For any suggestions or comments, please send an email to unitrap@crg.es