Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10292E8
Clone ID IST10292E8
Vector VICTR76
Project tigm

Sequence tag IST10292E8HMF1
Sequence
ATGCCAGGTAACACAACCAGGCTTGCTTGGAGAGGAGCTTTCTACTGCCCTGTCATGGCTGGAGACACTAGCATTGGGCT
ATGAAAACCTCCACAGGAGGACATTCCTGCCTGTGGGAGTAGAGTGAGAGGTTGTAGGAGATGCCTGTCAGCCAGAGCTA
GCCCACAAAGGAGGATTTGGTGGCGCATGGTCTTCTTAGGTTTGACTGATTTGGACCCCTTTGCCAACCCANCACCTGGC
ATCAGAATGGAGAACTGGGGCTAGGTTGAGCCTGCGTACTGGTACATTCTAAAGACTGAGGTTCTTACTACCANATCTTC
CCATCAGGACGGAACCNCNGTGTGTTTACCTATCTTANAGAAGAGAGCCCCTAAAGCAAGGAGCCTTGACTGGGAAGCAC
CNAGGGANAATGAAGTCATTCTCGCAGATTACNNCNCAGNGT
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100254634..100255075 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es