Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST450594
Clone ID OST450594
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST450594
Sequence
TCGCATCTATGCCACCTCTTTGCCCAATTGGTAGTCACCCTAAAGTGCAGAGCCCCAAAGCTGTGACTGGAGGACTTGGG
GCTTTCACAAAGGTGATCATCAAACAGGAACCTGGAGAAGCTCCTCATGTGTCCACAACAGGAGCTGCGAGCCAGTCAGC
ATTCCCTCAGTATAAAATAAAATTTG
Sequence Type mRNA
Unitrap ID UNI17032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20193248..20193797 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es