Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12019A9
Clone ID IST12019A9
Vector VICTR76
Project tigm

Sequence tag IST12019A9BBF1
Sequence
ATTTGTTTCCTTAAGAATCATTCTCCCTGGCTCGGCAGTTAAGAGGACACGATGCTCTTCCTGGAGACCCAAGTTCAGTT
CTCAGTCCCCACACCAGATAACTTAAAACTGCTTCAGTAACTCTAGCTCCAGGGACCCTGGCACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125394445..125394589 145
NO GENE  


Sequence tag IST12019A9HMF2
Sequence
GANNTCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTAAC
Sequence Type genomic DNA
Unitrap ID UNI36075 UNI36076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 158612992..158613063 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033557 (C530043G21Rik) NM_145413 family with sequence similarity 20, member B Gene [Source:MGI Symbol;Acc:MGI:2443990]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52196815..52196886 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 80026756..80026827 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3814838..3814909 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35963862..35963933 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90627045..90627116 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 144226167..144226238 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040151 (Hs2st1) NM_011828 heparan sulfate 2-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1346049]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107998106..107998177 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123700824..123700895 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3202996..3203067 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123186726..123186797 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44576111..44576182 72
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 166423323..166423394 72
NO GENE  

 
Come back to gene ENSMUSG00000040151


For any suggestions or comments, please send an email to unitrap@crg.es