Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14398H10
Clone ID IST14398H10
Vector VICTR74
Project tigm

Sequence tag IST14398H10BBF1
Sequence
AGGACAGACAGCTGCTGGTGTCTCTGGATGCTCACAGCCTAGGGCACATTTGAAAGGTCNTGCTCTGAGCTGAGCCCTGA
NTTCCAGCCTTGTAGCCNGCAAGGGAGTTTATTTAAGGTTCTGGAAGCATCAGCTATGACCCAAAGCACACGCTCCTCAG
AAAANCCCCTGTTTCTGTCGCTGCTGCTTTCTGTTTCTCTGTCGGGGCCACCAGGGCNAAACACCCACCAGTCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI19739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21571373..21571609 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es