Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13946A5
Clone ID IST13946A5
Vector VICTR74
Project tigm

Sequence tag IST13946A5HMF1
Sequence
CCAGGACAGCCAGGGCTACACTGAGAAACCCTGTCTTGA
Sequence Type genomic DNA
Unitrap ID UNI17455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10259915..10259953 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 58720535..58720573 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114264851..114264889 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76162302..76162340 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6184582..6184620 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 120603808..120603846 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130591422..130591460 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47429277..47429315 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 52174730..52174768 39
NO GENE  

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es