Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11044H4
Clone ID IST11044H4
Vector VICTR76
Project tigm

Sequence tag IST11044H4HMF1
Sequence
ATTTTAAATACTTGGCTGTAAAGGGGCAGTGACTAATTGCACTTTTAATCAATTTTTTTAAGGAGCAGTTGTAACTAGAA
GGCTTGTAAAGTTATTAAGAGTTACATGTGCATAATTTATTTATTAACTAGAAATATGCATAAGCAATTGTAAATTTGAG
AATTAATAGTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCTCAGAGATATGGCATTGACTATTAATATACAAATTA
AGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGTGT
CTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGANGATGANAAAAATGACTTTAC
AATAATGTTTTCTTTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776707..115777125 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920001..52920419 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469076..7469494 415
NO GENE  


Sequence tag IST11044H4BBF1
Sequence
ATTTTAAATACTTGGCTGTAAAGGGGCAGTGACTAATTGCACTTTTAATCAATTTTTTTAAGGAGCAGTTGTAACTAGAA
GGCTTGTAAAGTTATTAAGAGTTACATGTGCATAATTTATTTATTAACTAGAAATATGCATAAGCAATTGTAAATTTGAG
AATTAATAGTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCTCAGAGATATGGCATTGACTATTAATATACAAATTA
AGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGTGT
CTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCNAACGATCGGCTGGGAGGATGAGAAAAATGACTTTAC
AATAATGTTTTCTTTTTGGCCNAAGAATTGTTTTGGGCACAACCNATTTTNAATTACCAATTAATAACAATTATAAAAGC
TTTATTTTTTGTAGAAACTTTTGTAGTAAACNNAAACCCTAAGTAATAAAAGGATATTGTCTCTGAATCTTTTNGN

Sequence Type genomic DNA
Unitrap ID UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776573..115777125 541
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920001..52920553 541
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7468942..7469494 541
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es