Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11013B8
Clone ID IST11013B8
Vector VICTR76
Project tigm

Sequence tag IST11013B8BBF1
Sequence
TTATATTAAAATGTCTAATGAAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11013B8HMF1
Sequence
TTATATTAAAATGTCTAATGAAGATCTGTAAAAGAATTCACCGTATTCTTTTAAATTGTGTGGTTATGTGCACGTGGGTG
CAGCTGTGGGAGAAAGCCAGAGACATTAGATCCCTGGAGCTGGAGTTACAGGGAGCTGTGAGCAGATGTGGATGCTANGA
GTCAAGCTTAGGTCCTCTGGAANAACAGCCTGTGTTCTCAAGTACTGANCCNTCTCTCTGGTTCCCNNATTTTTTTTTTT
TTNNAAT

Sequence Type genomic DNA
Unitrap ID UNI16210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74795862..74796102 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es