Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST450392
Clone ID OST450392
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST450392
Sequence
GTGGTGGAACTGTGAATTCTAGACAAACCCAGAAGCGAACTCGGGAAACAACTTGNNCCCCTGAGGNTTCCTTGNAAACA
GAACCCNTAGAACATTGTGGANANTGTTGGAGATGAAATTGTGGACCTCACCTGTGAATCTTTAGAGCCCGTGGTTGTGG
ACCTGACTCACAATGACTCTGTTGTGATTGTTGAAGAAAGGAGAAGGCCAAGGAGAAATGGGAGGAGGTTGCGCCAAGAC
CATGCTGACAGCTGTGTGGTGAGCAGTGATGATGAGGAGCTGTCTAGGGACAAAGATGTGTACGTGACTACCCATACTCC
TCGAAGCACCAAGGATGATGGAGCTACTGGACCCAGGCCCTCAGGTACCGTCAGTTGTCCTATCTGTATGGATGGATACT
CTGAGATTGTGCAGAATGGGCGTCTCATTGTTTCTAC
Sequence Type mRNA
Unitrap ID UNI11812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34689446..34693911 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029110 (Rnf4) NP_035408 ring finger protein 4 Gene [Source:MGI Symbol;Acc:MGI:1201691]

 
Come back to gene ENSMUSG00000029110


For any suggestions or comments, please send an email to unitrap@crg.es