Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14556F5
Clone ID IST14556F5
Vector VICTR74
Project tigm

Sequence tag IST14556F5HMR1
Sequence
GGATATTNACATATTGATTGAAATTTTGAAACTTCTACAAATTGTTGCTCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI16679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125679140..125679193 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027206 (Cops2) NM_009939 COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) Gene [Source:MGI (curated);Acc:Cops2-001]


Sequence tag IST14556F5HMF1
Sequence
TCCTANNTAAAAGTTTAAAAAACATGTAAAATAAAGTCACTTGATATTATAAAAAGGCTTTACAAANCNNNNNGTTCAGT
CATGGCTCCAACTTCCTGATGAAATAACTCAAATGTCTCGAAAGCAGTCTGTGATGACCTATATCTAAATCTATTCTCTT
TCCCCCCAAATATGCCATATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027206


For any suggestions or comments, please send an email to unitrap@crg.es