Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14436F10
Clone ID IST14436F10
Vector VICTR74
Project tigm

Sequence tag IST14436F10HMF1
Sequence
CTATCAGGTCTACCATTCAGAAGTAGGGCCAGGGAATTGCCCCCAGATGACTCTGATCCAGTAAAAAATTCTGGAGTGAC
ACTCACTAGAGCATTTCCATCATCAGTGATGGCCCTATTGGCTCTCGGTAGACTTGGATACTAGGGGCTGCCCCGAAGGG
CCTTCTCACTAAAGAAGATCACACTTANCTGGATGTGNTGGCNCACGCCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74394498..74394708 205
 
EST/CDNA Est Name
  CJ120847.1 - BB862037.1 - CJ108737.1


Sequence tag IST14436F10HMR1
Sequence
ATAGCCCTTTCTTTCTTGAGCNNTGGTATTGCTACACNNNCNNANNTNNCGGTGGTGGGTCNGTGNCTGGCTTTTAACTC
AAAGTCACAATCCTCCTGCCTCAGCTTCCATAGTAGCTGGTATCATAGACATGGGGCACCTTGCCTGGCAATAGGGAAGA
ATTTGAGCAGGCACATTAATTGACAAGTCTACAGGACTGTGGCAGGCATGACCTTGAAGGTTTAACATGTGTGATCTCAT
TTTGACCCCCAATGGCCCTAANAANAANGCNCTATTTTTTTTAAAAAGATTTATTTATTANNNNNTGTAAATACNCTGNA
NCNGN
Sequence Type genomic DNA
Unitrap ID UNI33541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74394183..74394501 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038807 (Garnl4) NM_001015046 GTPase activating RANGAP domain-like 4 Gene [Source:MGI (curated);Acc:Garnl4-001]


Sequence tag IST14436F10BBF1
Sequence
CTATCNNGTCNACCATTCANAAGTAGGGCCNGGGAATTGCCCCCANATGACTCTGATCCANTANAAAATTCTGGAGTGAC
ACTCACTANAGCATTTCCATCATCAGTGATGGCCCTATTGGCTCTCGGTANACTTGGATACTAGGGGCTGCCCCGAAGGG
CCTTCTCACTAAAGAAGATCACACTTANCTGGATGTGGTGGCGCACGCCTTTAATCCCANCACTTGGGAGGCAGAGGCAG
GCAGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGTGAAACCCTGTCT
CNNNAAAAAAAAANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038807


For any suggestions or comments, please send an email to unitrap@crg.es