Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14297B8
Clone ID IST14297B8
Vector VICTR74
Project tigm

Sequence tag IST14297B8BBF1
Sequence
AGGCCAGCCTGGTCTACAGAGATCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAACAAACAAACAAACAA
ACAAACAAACAGGTAAAGTTGGGTCTTTTCAAGTCGCTGCAGTTCAAATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102339688..102339822 117
NO GENE  


Sequence tag IST14297B8HMR1
Sequence
NNCCCAAGTGCTGGGATTAAAGGCGTGCACCACCACTGCCNAN
Sequence Type genomic DNA
Unitrap ID UNI8146 UNI11528 UNI32383 UNI34359 UNI36079 UNI36080

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11829939..11829976 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10234221..10234258 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3652312..3652349 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7182828..7182865 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9575245..9575282 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22014488..22014525 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039197 (Adk) NM_134079 adenosine kinase Gene [Source:MGI Symbol;Acc:MGI:87930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12327682..12327719 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8680408..8680445 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7740007..7740044 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10610764..10610801 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5580016..5580053 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4546999..4547036 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19961479..19961516 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002428 (Hltf) NM_009210 helicase-like transcription factor Gene [Source:MGI Symbol;Acc:MGI:1196437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 25321100..25321137 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 12123515..12123552 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3474332..3474369 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001376 (Ccdc132) NM_024260 coiled-coil domain containing 132 Gene [Source:MGI Symbol;Acc:MGI:1920538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14021063..14021100 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10436982..10437019 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039057 (Myo16) NM_001081397 myosin XVI Gene [Source:MGI Symbol;Acc:MGI:2685951]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7711304..7711341 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 235988..236025 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6927999..6928036 38
NO GENE  

 
Come back to gene ENSMUSG00000039057


For any suggestions or comments, please send an email to unitrap@crg.es