Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13099A12
Clone ID IST13099A12
Vector VICTR76
Project tigm

Sequence tag IST13099A12HMF1
Sequence
GTCNCGTTAATTCCCATTTTGCCAACACCAGGGGCCCAGGCAGACGAGTTACCAAGGAACACAAAATTTTAATTAGTGTA
TTTTAATCATTCAGGCTTTCCGAGCTAATCCACACGCCCTAGAGAATTCCCGAGATGCAGCTCTGCCCTGCTTTACCATT
TATTGTTGAGTCNATTATAATTACTGTTAGCAGGTGGGGACTGGGAGATGTTTATTATGAGTTTTTCATCTTTAGTATAA
TTACCGAAAAAAACAAAATAAAAAGATGTCGTTGTATTTTGTTTCCTANAATTCTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148234863..148235168 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST13099A12BBF1
Sequence
NNCNNGTNNNNGNNCNNTTNGNNNNNACCANGGGCCCNNGCNNACGAGTTACCAAGGAACACAAAATTTTAATTANTGTA
TTTTAATCATTCAGGCTTTCCGAGCTAATCCACACGCCCTANAGAATTCCCGAGATGCAGCTCTGCCCTGCTTTACCATT
TATTGTTGAGTCTATTATAATTACTGTTAGCAGGTGGGGACTGGGAGATGTTTATTATGAGTTTTTCATCTTTAGTATAA
TTACN
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148234889..148235106 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es