Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14186B12
Clone ID IST14186B12
Vector VICTR74
Project tigm

Sequence tag IST14186B12HMR1
Sequence
NCCNTTACNCATTTTGAGCCNTCCTGCTGGCCCATAAATCTTCTGCATAAAATGTGGAGACTGAATGGAANATCTGTGTT
GTTTCCTTAAGCTTCAGGGGTTGAGTCTTTANCCTCACATATGCTTGGCAACTACTCTACCAGTGAGCTATGTCCCTANC
CNTGAATGATCTATGAAAATAAAAAAACTTCACACTTTAATATCNNTGTTTTTAACATGAAAGAGAAAATGATAGTTTTA
TTAAACTANTTAATGCTTGCACACAATTACATACATTTTAAACTGCCAGGATTTTTGATAAGTACAATACCATTTTCNGA
TAANCATAGTATAACTTTAAATATTACATCATTCANACTCATGTTGGAAAACATTAACNNNTNNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63189965..63190341 351
 
EST/CDNA Est Name
  BY412785.1 - BY612049.1 - BY574166.1 - BY617288.1 - BM899947.1 - CJ201473.1 - CJ200076.1 - CJ201510.1 - BB780759.1 - BB777485.1 - AV083607.2 - BU531017.1 - BB738722.1 - BB741432.1 - BF135076.1 - BB705339.1 - AI661413.1 - BM194976.2 - BY467047.1 - BY410790


Sequence tag IST14186B12BBF2
Sequence
GTAGGAGGAAATGAATCCTACAAATTCTACACATACAAATATAGCCAGCCTGGGCTACAGAGTTAAGATCCTGTCGAAAG
CTGGGTATGGTGGAATACCCCTTTAATCCCAGCACTAAGGAGGCAGAGGTAAGCAGATTCCTGTGAGTTCAAGGCCAGCC
TGGTCTACAGAGTGAGTTCCAGGACAGCCAGGATTACACAGAGAAACCCTGTCTCGAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63189677..63189913 237
NO GENE  


Sequence tag IST14186B12HMF1
Sequence
GCACAAATACATGAAGGACCTTCAAGGATTCTGCTGAGCATGCTCAACATCCCTGCCTACACGTGGGAGACGCAGGGGGC
ATTGATGTAGCTGACCGCCGTCCACCCGTGCAATCAAGGGCAGGTGAAGAGCAGAAGTGTTGGCCCCTTTGGCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI16296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66492110..66492266 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es