Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13084H11
Clone ID IST13084H11
Vector VICTR76
Project tigm

Sequence tag IST13084H11HMF1
Sequence
ATGACCTCATTATGAGTCCTCCTCCCATCTGATACTGCTCTGCTCTTTATTTGACCTAAAAAGATATAAATTCCTTCTGT
ATCCTAACAGCACCCAGCTCTGCCGAGTCCTGCTCACACCTCTTTATGCTTATACTGCATTTGTTTGCCCAGATCCCAGA
AGTCTCGCTGGTTTTTGTCTTCTCTGGATCCAGGCTTTTCTGAACCTCCCTTGGAGCAGCATTGTCCCTTTGACCATTTC
CTCCTCCTGGGCTATTCTTGTTCCTGGTCTCTTGGCTCTGGCATCCTCAGGTCAGGCTCTTTTTGGACCCCTCTCTTCTG
TTTAGCCCAGTGAATGGGTGCTTCANTAAGTTCTCTTTGTTCCTTTTGCTCTTATGGGCGTTTCNAATCTGTCAGCTGCT
CTCTGTGTGCANATTTGATCCTTACAGATTTGGTCTTTGCNNATGTN
Sequence Type genomic DNA
Unitrap ID UNI35988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22641729..22642174 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]


Sequence tag IST13084H11BBF1
Sequence
ATGACCTCATTATGAGTCCTCCTCCCATCTGATACTGCTCTGCTCTTTATTTGACCTAAAAAGATATAAATTCCTTCTGT
ATCCTAACAGCACCCAGCTCTGCCGAGTCCTGCTCACACCTCTTTATGCTTATACTGCATTTGTTTGCCCAGATCCCAGA
AGTCTCGCTGGTTTTTGTCTTCTCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI35988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22641729..22641918 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]

 
Come back to gene ENSMUSG00000035919


For any suggestions or comments, please send an email to unitrap@crg.es