Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14170F3
Clone ID IST14170F3
Vector VICTR74
Project tigm

Sequence tag IST14170F3HMF1
Sequence
GTTTTAAAACAAAGACATGGAAACTCAACACTGCAAGACTGCTGTTCCCTGANCCCACAGAGAGCAGGGGAGCGTGAGCA
GCGTTTCCGCCATCAGCGCACACAGCCCAGCTTTCAGGCTACAGAATGCTCCTATCACTACAATACTCGGTGCAGGTTCA
AGTCCAGGGCTGGTACATGCAGGGCAAGCACTCTATACCTCATACAATTTCACTTTTTTCTTTTTCAGATCAACTCTAAG
TAGTGAAAGTTCTTCTTTGTCTTCTTTGANACAAGGTCTCACGTAGCCTANGCTAGGCCTGAAGANGCTGCTGAACGCTT
GACCCCTCCGCTTCCCTTACACAGCGTCNCGGATGGATCTCANAACCTTGTGCATGCTNNCAAGCACTCTGCAAACTGAG
CTACATCTCANCCCGACTTCTACCCTGTGCTTGTACCTCAAAGGNTTCCCAAATGANTCTCTGCTCCCTGANGAGNANAG
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53143112..53143593 450
 
EST/CDNA Est Name
  BQ557423.1 - BM121142.2 - CD543969.1


Sequence tag IST14170F3HMR1
Sequence
AAAACAATAACTAAAATTTTGGAAGCTGTGCAGAAATTAAATTGTTCTTTGTAAAAGTGTGAAATGGGCCGGGCAGTGGT
GGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGT
GAGTTCCAGGACAGCCAGGGCTATACANANAAACCCTGTCTCAAAAAAACAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI33436

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53143589..53143818 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es