Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST450264
Clone ID OST450264
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST450264
Sequence
GACTGAGGCCGTTGGAGCGATCTAGTGAAGATGTGGACATAATTTTCACGCGGCTGAAAGGAGTTAAAGCTTTTGAGAAA
TTTCACCCAAACCTCCTTCGTCAGATTTGTTTATGCCGGTTACTATGAGAACCTGGAAAAAGGAATCACACTGTTTCGCC
AAGGGGATATTGGAACCAACTGGTATGCTGTCCTGGCTGGGTCTTTGGATGTTAAAGTGTCTGAGACCAGCAGTCACCAG
GATGCGGTGACCATCTGCACTCTGGGAATTGGGACAGCCTTTGGAGAGTCCATTCTGGATAACACCCCTCGCCATGCAAC
CATCGTTACCAGGGAGAGCAGCGAACTTCTCCGCATTGAGCAGGAGGACTTCAAGGCACTATGGGAGAAATACCGACAGT
ATATGGCCGGACTTCTGGCTCCTCCCTATGGTGTTATGGAAACGGGCTCTAACAATGACAGGATTCCTGACAAGGAGAAT
Sequence Type mRNA
Unitrap ID UNI17050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71869088..71979229 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049044 (Rapgef4) NM_019688 Rap guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI (curated);Acc:Rapgef4-003]

 
Come back to gene ENSMUSG00000049044


For any suggestions or comments, please send an email to unitrap@crg.es