Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14591H3
Clone ID IST14591H3
Vector VICTR74
Project tigm

Sequence tag IST14591H3BBF1
Sequence
GGGTAATAAGAGGAGCTGACAAAGAGGCTGGAAATGAACAGAGAGGACAGAAGCCCACGCGCGGAGGATGGGAGACTCAC
CCCCCTCCGCGCCACATCTAGAGCCCATGGGGCCATTCGCTTCTCTACCTCCCACCCGGAACAAATTAATCCTCCGCACT
CCAAACCGAGGGCCACATGGGGGAGTTTGGGGCAGCTCCACCCCATCGCCACCCCCCCTCCGCCCCCAAAACCAGGCCGG
ATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89855631..89855873 243
 
EST/CDNA Est Name
  AA517430.1 - BY775750.1 - BY035132.1 - BY072020.1 - BY325262.1 - BY782022.1 - BY305957.1 - BY068989.1 - BY037076.1 - BY125156.1 - BY024495.1 - BY142162.1 - AI787738.1


Sequence tag IST14591H3HMF1
Sequence
GGGTAATAAGAGGAGCTGACAAAGAGGCTGGAAATGAACAGAGAGGACAGAAGCCCACGCGCGGAGGATGGGAGACTCAC
CCCCCTCCGCGCCACATCTAGAGCCCATGGGGCCATTCGCTTCTCTACCTCCCACCCGGAACAAATTAATCCTCCGCACT
CCAAACCGAGGGCCACATGGGGGAGTTTGGGGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89855631..89855823 193
 
EST/CDNA Est Name
  AA517430.1 - AI787738.1


Sequence tag IST14591H3HMR1
Sequence
ACCCTGCCTTCTTTCTTACCGACCCTGGTCGTGGAATATATTTTCGCTGCAGTCTTTGACTTCCTGTTGTCTATACTGTA
NTTTTGGCTACCCAAGCAGTTATCTTATTTGGGAAGCTGGACATGGAGGCCCCCGTGGATTGTGTTGCGCCTAANGGATG
TCACTANACTGGGCATTTGTTCATTTTTCTNATAATGGGAATGGAATTCCAAATTTCTTGANACCCNNCNNNNNNNNNNN
NGNNNNNNCNNTGNTTTGCAAAGTGATGTCACAAACAAGAGACTGTTTTCCACGATTCTTAAAATTTANCAACCTCTGGT
GTANGTTGTTGTGGAAAGAAAAAACAGTTNNNGGCNATTTTGTTAAATTTGTTTTNNCCTTTGAN
Sequence Type genomic DNA
Unitrap ID UNI18328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89855251..89855634 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es