Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14577A8
Clone ID IST14577A8
Vector VICTR74
Project tigm

Sequence tag IST14577A8HMF1
Sequence
ACCAACACTTACTGACAGAGAGCAACAGCTGACACTTATCANCAGCATATGTGAGGGCAGAACTGTAACTCTCACCAAAA
TGCCTCCAGATGAGTAAAATTACCCCAATTTACAGATGAATATAAAGATCCCTTACCAAGCGTACAAAGATGTGAGAAGT
CAGACTACAACCACTCCTCTCCCCACCCCCTCACTTCATCTCATCTTATCCCTCACCTCGCTCCACCTCACCCAACTTCC
CTACTCCTCACCCCAAGCTGGCTGCACAGCCGTCCCTACAAGCAGGGTTTTGTGGAATACTCATTAGAGTTTGTAAAGGT
AAGGAGGGCTGGGCTGATCCTGTGTCTGCCTGACAACAGGGAGTGCANTCTGCAAAGGGACTCCNATANGAAGTCNAGGA
ANANCTCAAGCANNGGCTCTGCCTGGGCAGGCCAGCAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116753266..116753705 422
 
EST/CDNA Est Name
  CA890489.1 - CA890519.1 - BB870071.1 - CK638702.1 - CD348626.1 - BU562111.1 - CN663728.1 - BY066411.1 - BY071647.1 - BB850627.1 - CA884734.1 - BY233666.1 - CA885244.1 - BB842928.1 - BY083400.1 - BB841739.1 - BY787505.1 - BY307298.1 - BY101780.1 - BY327809


Sequence tag IST14577A8BBF1
Sequence
ACCNNNNCTTACTGACAGANAGCAACAGCTGACACTTATNANCANCATATGTGAGGGCAGAACTGTAACTCTCACCAAAA
TGCCTCCAGATGANTAAAATTACCCCAATTTACAGATGAATATAAAGATCCCTTACCAAGCGTACAAAGATGTGAGAAGT
CAGACTACAACCACTCCTCTCCCCACCCCCTCACTTCATCTCATCTTATCCCTCACCTCGCTCCACCTCACCCAACTTCC
CTACTCCTCACCCCAAGCTGGCTGCACAGCCGTCCCTACAAGCAGGGTTTTGTGGAATACTCATTAGAGTTTGTAAAGGT
AAGGAGGGCTGGGCTGATCCTGTGTCTGCCTGACAACAGGGAGTGCAGTCTGCAAAGGGACTCCNATAGGAAGTCAAGGA
AGACCTCAAGCAAGGGCTCTGCCTGGGCANGCCAGCAAAAAGGGGGAANGCAANAAGTNNTCCTTGAAANANCATTCCTG
CATACAAAGCNNGCNNGGAGGGGTCCACCANANCTGCNTTNANANAGANCACATGCTCGCTGAACATCNGANTGNCNCCN
NNGANCNCACACTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14577A8HMR1
Sequence
GTGACCTCTCCTTGTGATCAATCCCACTGACACATGGCGGAAGAATACATGAGCCAGGTAGTTAGCATGTCTGACTTTTA
GTTCTGGCCCTATCTGACTGTCGGCTCTCANTTTCTTCTCCTAAAAAACAGATGGATTAAGAGTTCTCATTGGCACTTTG
ACTTATCACATGTCAGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116753088..116753267 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es