Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13129F6
Clone ID IST13129F6
Vector VICTR76
Project tigm

Sequence tag IST13129F6HMF2
Sequence
CAGGTTTCAATCCCACAGTAACACCTTCTGCAGCACCCCACCTGCTCANACTGCAGCCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI32283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26247302..26247363 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074272 (Ceacam1) NM_001039186 carcinoembryonic antigen-related cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1347245]

 
Come back to gene ENSMUSG00000074272


For any suggestions or comments, please send an email to unitrap@crg.es