Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15106H12
Clone ID IST15106H12
Vector VICTR80
Project tigm

Sequence tag IST15106H12HMF1
Sequence
ACGGTCTTCTTTGGATTTTGGAGTATCGCTTCCTGCCCCCGCCTTCCCTCCCCGCCCCATTCTCTGTCCTATTGAACACC
TCGCCCAGCCTAGAGCTCACATTCTCCCCCTGCTCCCGATGGCGCTCCTGGAAGCTCTGCAACTATGCTCCACTTCAAAT
GGGTGAGTTTAAAAAACCTATCTTACCTCCGATTCCTGCTTCCTGCTTCCCGCAAACCCCATCTCTTAGGATTGTTGCAT
GAGGCACGCTTGCCCTGGGGGAAGGCAGATGCATATTTTCCTCTCCGCAGTCNATCGTGCTAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI36085

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 41389324..41389631 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074415 (2610203C20Rik) RIKEN cDNA 2610203C20 gene Gene [Source:MGI Symbol;Acc:MGI:1917705]

 
Come back to gene ENSMUSG00000074415


For any suggestions or comments, please send an email to unitrap@crg.es