Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST450232
Clone ID OST450232
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST450232
Sequence
GACTGAGGGGCTGCATGGCCCAGCGATCTGGCAAAGGCCAAGAAGCCAAAGACTGTTGAAGCCGCAGTCTCCACTCTTCT
ACTGACGCCAGCGACCACCCAGCCCAGCCAGGCCATATGGCCTCCTGCTTGCCTGATGTATGAGGTGGGTAGCAAGCTTT
TCACCCAGAAGAGGACGTCCGAGGGATTAATTACTTAAAATCCATAAACATGTATCATTATAA
Sequence Type mRNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93942435..93942652 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es