Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0595
Clone ID AL0595
Vector pGT0lxr
Project sanger

Sequence tag AL0595
Sequence
GATGGTTTNTTATATGGTGATGTGTATCGTTTACATATTATATGGTGTCCTCTGGCTGCTGTGGTCTGCCTGTTACTGGA
AAGATATATTAAGAATTCAGTTCTGGATTGCAGCTGTTATTTTCCTAGGAATGCTTGAAAAGGCAGTTTTTTATAGTGAA
TACCAAAACATCAACAGCACTGGACTGTCAACTCAAGGTTTACTGATATTTGCAGAGCTGATATCTGCAGTTAAGAGGAC
ATTGGCTCGCCTGCTTGTGTTCATTGTGAGTTTGGGTTATGGCATTGTGAAGCCTCGCTTAGGAACAGTGATGCACCGGG
TGATTGGACTGGGACTGCTTTACTTGATCTTTGCAGCCATTGAAGGCGTCATGAGAGTCATCGGG
Sequence Type mRNA
Unitrap ID UNI3235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128657188..128663131 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014353 (Tmem87b) NM_028248 transmembrane protein 87B Gene [Source:MGI (curated);Acc:Tmem87b-001]

 
Come back to gene ENSMUSG00000014353


For any suggestions or comments, please send an email to unitrap@crg.es