Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10048A11
Clone ID IST10048A11
Vector VICTR75
Project tigm

Sequence tag IST10048A11BBF1
Sequence
TTCAAACTTTTTTTTTCTTCTGCATTCTCTTTTTCTCAGATATTCCAATTGCATGTGTTAGATACTTTCTCCCTCCATTC
TTGGATGCTCGGTTCTCCCACCACCCCATCTCTAACACTGTCTATTTTAACTATGGCTGTGATAAAAACACCCTGAGAAA
AGCAACTCAAGGACAAGGGGCTTTGTTTTGAGTCACAGTTAAAGCTACTGCAATCTGTTGGGGTGGTTTTTTGTGCACTG
TGTAAAGGCTGTCTTTGTATTCTTTAAATGCTGATTTCTGAGCTGGCAGAGAGTTGAGTGCAGATGGCTTGGTACTGTTA
TTCAAATGGCTACATCATAGTTTGTAAACTCTCCCTCCCTCCCTCACCTTTTGATTGGTTTAATGAAAGGTTAATCGCCT
ATAGCAAAGGAGGAGAGAATAGGCAGGACTTCTGGGCAGAGACAGGAACTCTGGGAAAGCCTCTGACATAGGAGGATTCA
CCAGCCAGACATGGAGGAATGAACCAAGATAACTGATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30729133..30729650 516
 
EST/CDNA Est Name
  BB621686.1 - BE534724.1


Sequence tag IST10048A11BBR1
Sequence
AAGACATAATGGTTGAGGATTTTTCCAAAATTAGTGAACCACAGATTCAAGAAATTCAGTGAACAGTAGGCAGTCACAGC
GATTCTCTTCTGGTCCTCTCTGTGCCCAAGCCCTAGCAACTCTAAAGGTCCTGCCCAGTGCTCAGCCACTGGCTATTGGC
ATGTTTATTGATGGATCAAAAACCAATTGGGGACAAGGACCTTTAGCATTTGGATACTCAGATTCCCAATTGAATCAAAG
CATTAGAACCAACCTCCAACAGCTATTGGCCATCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI33340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30728856..30729134 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es