Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14408B12
Clone ID IST14408B12
Vector VICTR74
Project tigm

Sequence tag IST14408B12HMF1
Sequence
AGCTCTGGTTTGTTAAATAGGCACCTCAATCCTAGGTTAATGGAAGAGCCCTCAGTCTCCTTTGCCAGAGAGAGATAAGG
AGAAAGACTCTTTTTAGCAAGTTGGGACTATCTTAAGTACCAGAGGGAGTGCTTGCTGGCTTTGTCTAAACACCAGACTT
TGGAAAAGGAGTTTCTTGGGATCTAACTAAGGCCTGCCTCAGTCTCCATAGCAGCTAGTATTAAACACNGGCTGTGTCAG
GCTNNNGTNNNNTTTNNGCTTGCTTCCGCCCTTGTNNTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14408B12BBF1
Sequence
AGCTCTGGTTTGTTAAATAGGCACCTCAATCCTAGGTTAATGGAAGAGCCCTCAGTCTCCTTTGCCAGAGAGAGATAAGG
AGAAAGACTCTTTTTAGCAAGTTGGGACTATCTTAAGTACCAGAGGGAGTGCTTGCTGGCTTTGTCTAAACACCAGACTT
TGGAAAAGGAGTTTCTTGGGATCTAACTAAGGCCTGCCTCAGTCTCCATAGCANCTANTATTAAACACAGGCTGTGTCAG
GCTCNNGTNACATTTANGCTTGCNTCCNCCN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84868111..84868380 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es