Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11853G11
Clone ID IST11853G11
Vector VICTR76
Project tigm

Sequence tag IST11853G11BBF1
Sequence
AGTGTACTCATAAACATAAAATAAATAAATAAATCT
Sequence Type genomic DNA
Unitrap ID UNI18393 UNI36091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107379450..107379485 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 25482875..25482910 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35679837..35679872 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52919750..52919785 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036053 (Fmnl2) NM_172409 formin-like 2 Gene [Source:MGI (curated);Acc:Fmnl2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131964108..131964143 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28089961..28089996 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002221 (Paxip1) NM_018878 PAX interacting (with transcription-activation domain) protein 1 Gene [Source:MGI Symbol;Acc:MGI:1890430]


Sequence tag IST11853G11HMF2
Sequence
GTGTACTCATAAACATAAAATAAATAAATAAATCT
Sequence Type genomic DNA
Unitrap ID UNI18393 UNI36091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107379450..107379484 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 25482876..25482910 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35679838..35679872 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52919751..52919785 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036053 (Fmnl2) NM_172409 formin-like 2 Gene [Source:MGI (curated);Acc:Fmnl2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131964109..131964143 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28089961..28089995 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002221 (Paxip1) NM_018878 PAX interacting (with transcription-activation domain) protein 1 Gene [Source:MGI Symbol;Acc:MGI:1890430]

 
Come back to gene ENSMUSG00000002221


For any suggestions or comments, please send an email to unitrap@crg.es