Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10124F12
Clone ID IST10124F12
Vector VICTR76
Project tigm

Sequence tag IST10124F12BBF1
Sequence
TAAGTACACTGTAGCTGTCTTCAGATACTCCAGAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI14672 UNI23557 UNI23836 UNI32336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 38380382..38380431 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61603550..61603599 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 106355422..106355471 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13727139..13727188 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27756316..27756365 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 82851269..82851318 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154517208..154517257 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038467 (Chmp4b) NM_029362 chromatin modifying protein 4B Gene [Source:MGI (curated);Acc:Chmp4b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88496124..88496173 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129967441..129967490 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123454903..123454952 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 47890439..47890488 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17270892..17270941 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58107286..58107335 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032333 (Stoml1) NM_026942 stomatin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1916356]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19830310..19830359 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037341 (Slc9a7) NM_177353 solute carrier family 9 (sodium/hydrogen exchanger), member 7 Gene [Source:MGI (curated);Acc:Slc9a7-001]

 
Come back to gene ENSMUSG00000037341


For any suggestions or comments, please send an email to unitrap@crg.es