Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14133C6
Clone ID IST14133C6
Vector VICTR74
Project tigm

Sequence tag IST14133C6HMF1
Sequence
CAANGAAGGGGGGGGCNGGTANAAAGAATGAAAGANCTGTANAAAAGGGTAAAGTCTTGTGAAAGGGCCATCTTCCANGC
NTGACATGGCTGTTACTCTCTGCCCCCCGACCCCCATCGGCTGTGATTTCCTGCANAANACCTGCACAAGATTAAACCTG
TTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14133C6BBF1
Sequence
CAAGGAAGGGGGGGGCNGGTANAAAGAATGAAAGAGCTGTANAAAAGGGTAAAGTCTTGTGAAAGGGCCATCTTCCAGGC
ATGACATGGCTGTTACTCTCTGCCCCCCGACCCCCATCGGCTGTGATTTCCTGCANAAGACCTGCACAAGATTAAACCTG
TTAACTCTCAGGAGGCCACACTACTTCTTCAAGATTTATACATGGTTAATGGCTTTCAGGGGAGACNCTCCTGAAAATTG
CCCATACTCCTGTAAAAATAATCTCTCGTGCAATCTCCTGTAATCAAATTCATTGGGTCTTAAAATTTTAAACTAAACAG
AAACTACAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109878867..109879201 323
NO GENE  


Sequence tag IST14133C6HMR1
Sequence
NTGATGTTCCCTGAGCCTTGTGGGGTCGATATTGGTGCTGTAGGGCTGANCATTCAGCACTCACTTCTTCCCAGCAGTTT
GACCAGTATGAGTCTGCAGTAATAGCTACCCATTGAAAGAAGCAGCTTCTCTGACTAAATATTTAGGGGGTATATTTAGG
CAGTTTGACAGGTGTANCATGTCTGTTTATTAAAACAACAGCTTTANCTTCCCCACTAGAGCCTATGGGCTTATTTGCCT
TAGGCCTTTTACCAGGGTTACAGTACCATGTATGGGTTTNCCTCTGTGGAACGGACCACANATCTTATAACAGTTATGAC
TNTGTTGCCGGGTANGTGNNTNNTNCNGCNNGNNGNNTGN
Sequence Type genomic DNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109879200..109879536 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es