Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14599H1
Clone ID IST14599H1
Vector VICTR74
Project tigm

Sequence tag IST14599H1BBF2
Sequence
ATAATTATATGCTATAAGCCTAGATTGGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856750..164856785 36
NO GENE  


Sequence tag IST14599H1HMF3
Sequence
ATAATTATATGCTATAAGCCTAGATTGGGCAGATCTAATACTAGCCTAACTTATTCCCCAGCTATAAGACACTTTGCTAC
TTGCAGTTTCTCCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856750..164856848 99
NO GENE  


Sequence tag IST14599H1HMR1
Sequence
AGTTGGAAATTCCAGCAACAAACTGAGTTTATTGTTTTTGAANCATGTTATCCAGCTCTCTGGCNNNGANNTGCANACTG
CTAACTCTCCAAGCCATAGCTAGGAGTTATTGCTTTGTTACTGGGGTCCTCTTTGAAGCATTTTGTTCTACTATCTAAAT
GCAACTTTTGGGAAAANNTTNNNAT
Sequence Type genomic DNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856537..164856712 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]

 
Come back to gene ENSMUSG00000039804


For any suggestions or comments, please send an email to unitrap@crg.es