Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15024A2
Clone ID IST15024A2
Vector VICTR78
Project tigm

Sequence tag IST15024A2BBF1
Sequence
GTCCGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACTTGTAATGAGATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3898604..3898661 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54996439..54996496 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34081671..34081728 58
NO GENE  


Sequence tag IST15024A2HMR1
Sequence
NNGGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCTGTTGTTATTTTTGGATAGCATC
TGGCTTTGACTCACAAGGTTGGTTTTGATTCTCTTACCTCCATCTCTCATTTGCTGGCACTATAGGTGTGTACTCATACC
CAGCCTCCAGGGTACTCANTATTAAACCCACCCTTCCTACCTTAACTCACGTTGCTTCTTTTCCCAAGTTCCTGGATTGG
CACCTCTCTCTGTCTTTGTATTACAAGAATAATCTATATTTCATTTTANAGTCCTCGGATTTCTTCATTTGCTAATTTTT
GTATGTTANNNNNAANNNNNNTNTNNTNNNNACTTATCNNANNAGGCACACCTTAAACCCGTCTTTGTCTCNNNNANCAC
ANTTNNNTTANANAAAAATTCTNNGCNNAGAATCATTCTGGTAGGCACGCNNATATTCCATANNGGAATGGTGTTGGCAC
TTANNNACCAN
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54996493..54996980 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es