Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10438C4
Clone ID IST10438C4
Vector VICTR76
Project tigm

Sequence tag IST10438C4BBF1
Sequence
CATCAAGAAGGGTGAGGCGGGCGCGTGGCGATCGCGGTCCGGGACCGGTGACTTGGGCGGCCCGGGGTCGAGCCTCGTGA
GCGAGGTGTCGGCTCACGCTTCTCTCTCTTTGTAGCTGTGAAGCANAAGCAGATTCGTCGCGGGGTGAAGGAGGTTCANA
AATTTGTCNACNAGGGCGAGAAAGGGTAANAACCCGGCTTCCTCTGGTTTTTAAGTTTTGTGTGGTTTTTATTTTTATAT
TCCNGTGCCGGGGATTGAACCTAGGGCCTTGTGCACGGTACACANNTNCTACGGCACTAANTTTGGCTTATTAACTGGTT
AAGAAGAAATTCCACCTACTCNATANANGTGAANNNGACCNACNNGTCTAGCNGTCAACTCCCTTCACTACCAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10438C4HMF1
Sequence
CATCAAGAAGGGTGAGGCGGGCGCGTGGCGATCGCGGTCCGGGACCGGTGACTTGGGCGGCCCGGGGTCGAGCCTCGTGA
GCGAGGTGTCGGCTCACGCTTCTCTCTCTTTGTAGCTGTGAAGCANAAGCAGATTCGTCGCGGGGTGAAGGAGGTTCAGA
AATTTGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI31280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51433469..51433639 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001056 (Nola2) NM_026631 nucleolar protein family A, member 2 Gene [Source:MGI (curated);Acc:Nola2-001]

 
Come back to gene ENSMUSG00000001056


For any suggestions or comments, please send an email to unitrap@crg.es