Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12934G8
Clone ID IST12934G8
Vector VICTR76
Project tigm

Sequence tag IST12934G8HMF2
Sequence
NTCTCTTATTCCCTACCCTTTGACCTTCCGGAGCAAATAAACCTCCTTTGTGTTGANAACTTGATCTTGGGGTGTCTTGA
GCANATACTGATTGCCACACATTTTGTGAGACACCTACNCAATTCTGGAGGGTCNTTGCCGACTTCAAAGTGGCTAGCCT
TTCTCTGTGCCCTGGCTACTGCCAGGGTCANTGTCCACCTGCCCTGAAAACTGTTTCCCTCTGCCCTCTATTCTGTCCCA
NCCTCANAACCTCACACAAAAACGGGTCCCATGCTTCCAACTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 96083768..96084050 267
NO GENE  


Sequence tag IST12934G8BBF1
Sequence
NCTNAGANNGGANTNNGNNNANNGNTGANTGTNANGNTNANCNCNGCNGGTGTNNNNNTGNNGGGNCCTTGGGCAGGAGA
AGGAAAATTANTCAACAGCTAATTGGATATCAATTTCTGCAACATGTGATTTGAACCTTTTTAAGAAACTGGCCTTTTCT
AGTGCCNGCTTCTCAAAAGAGATTGAACTAGCTTTAATAACATTGAGTTTAAAAGANANAN
Sequence Type genomic DNA
Unitrap ID UNI26806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40548333..40548482 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]

 
Come back to gene ENSMUSG00000020328


For any suggestions or comments, please send an email to unitrap@crg.es