Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST449835
Clone ID OST449835
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST449835
Sequence
GAGTTTGGGAATCCTGCTACTGCAACTCAGTTCTTCAAGCACTTTATTTTTGTCGTCCATTTCGGGAAAAAGTTCTAGCA
TACAAAAGTCAGCCCAGAAAAAAGGAGAACCTTCTCACCTGCCTGGCAGACCTCTTCCACAGCATAGCCACCCAGAAGAA
GAAGGTCGGCGTGATCCCCGCCCAAGAAGTTCATCACAAGGTTGCGGAAAGAAAACGAGCTGTTTGACAACTACATGCAA
CAAGATGCCCATGAATTCTTAAATTACCTACTCAATACAATTGCTGATATTCTACAAGAAGAAAGAAAACAGGAGAAGCA
AAATGGCCGATTACGGAACGGAGACGTGGACAACGAGGATAACAACAGCACACCAGACCCAACCTGGGTCCACGAGATCT
TTCAGGGAACATTAACTAATGAAACCAGGTGTCTTACTTGTGAAACTGTAAGTCCATCCGCATAGCTGTCAAAAAAAAAA
A
Sequence Type mRNA
Unitrap ID UNI16407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147565923..147574992 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029640 (Usp12) NM_011669 ubiquitin specific peptidase 12 Gene [Source:MGI (curated);Acc:Usp12-001]

 
Come back to gene ENSMUSG00000029640


For any suggestions or comments, please send an email to unitrap@crg.es