Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST449707
Clone ID OST449707
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST449707
Sequence
TTCTGAGGTCGATCCTTCGGGTNTCACAGTCTCATCGTGTCTCGGACAGGATGGCAGAGGGTACAGGTGGTGGTGATCTC
CTGACAGCTGGACCTCCCACAATGTCANAGCTCACGCTTGGGCTGCCCACTCTACCCTTCTCTTTCTCNTTCAGTAGNNT
AATAATTGTTTTTCTAAACATTAAACCATCAAGACTTCTGAAGAGCAGAAGGCTACACTCTGAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17078

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129653508..129653723 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037885 (Stk35) NM_001038635 serine/threonine kinase 35 Gene [Source:MGI (curated);Acc:Stk35-001]

 
Come back to gene ENSMUSG00000037885


For any suggestions or comments, please send an email to unitrap@crg.es