Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11836G3
Clone ID IST11836G3
Vector VICTR76
Project tigm

Sequence tag IST11836G3HMF1
Sequence
CCATGTGGTTGCTGGGATTTGAACTCAGGACCTTCGGAAGAACAGTTGGGTGCTCTTACCCACTGAGCCATCTCACCAGC
CCC
Sequence Type genomic DNA
Unitrap ID UNI36096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122667179..122667261 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 74936365..74936447 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034593 (Myo5a) NP_034994 myosin Va Gene [Source:MGI (curated);Acc:Myo5a-001]


Sequence tag IST11836G3BBF1
Sequence
CCATGTGGTTGCTGGGATTTGAACTTCGAACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCANC
CCC
Sequence Type genomic DNA
Unitrap ID UNI5042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 118744928..118745010 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6430503..6430585 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52632425..52632507 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 85314026..85314108 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66394743..66394825 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034647 (Ankrd12) NM_001025572 ankyrin repeat domain 12 Gene [Source:MGI (curated);Acc:Ankrd12-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102993454..102993536 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138031538..138031620 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122844640..122844722 81
NO GENE  

 
Come back to gene ENSMUSG00000034647


For any suggestions or comments, please send an email to unitrap@crg.es