Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14784E11
Clone ID IST14784E11
Vector VICTR76
Project tigm

Sequence tag IST14784E11HMR1
Sequence
CTAGCACAGTGAAGGGCTAGAGTCACATTGTATCTTTAACTTGTGTTACTTTTATTGTATCATTTTCTATTGTTTGGGGT
TTTTTTTTTCCGGTTTTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22751959..22752056 94
NO GENE  


Sequence tag IST14784E11BBF1
Sequence
TTAGTGTGGCAGGCTCTGTAGCACAAGCTGAGTGCCCAGCCATGTTTCAGAGGCATCTTTCTGAGGCCTTGATAGGTACC
AGTTGTACCTTGTTTGCTTTGCTTGTTTAAATGAGAGGCAACCATTTTACTATTCTTTGCCACATAAGGAATTACCTCTC
TTCAAATGAACTTAAAATATCTCCTATTTTTAACTAAAAATATACTCCTATTTTTAACCGAGTGTTTTCTTTTGAGTTTT
TGTTCTCAAGGTTCTGTTGGGTCTTCTGTTAAAAAGGAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22751674..22751961 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]


Sequence tag IST14784E11HMF1
Sequence
TTAGTGTGGCAGGCTCTGTAGCACAAGCTGAGTGCCCAGCCATGTTTCAGAGGCATCTTTCTGAGGCCTTGATAGGTACC
AGTTGTACCTTGTTTGCTTTGCTTGTTTAAATGAGAGGCAACCATTTTACTATTCTTTGCCACATAAGGAATTACCTCTC
TTCAAATGAACTTAAAATATCTCCTATTTTTAACTAAAAATATACTCCTATTTTTAACCGAGTGTTTTCTTTTGAGTTTT
TGTTCTCAAGGTTCTGTTGGGTCTTCTGTTAAAAAGGAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22751674..22751961 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es