Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST449469
Clone ID OST449469
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST449469
Sequence
TGGGCCGCCACGGTGGCCACAGCTTCGCCTACCTCCAGGATGCCCTGCAGGACTCTCGGGCACTCACCATCCAGCTGCTG
GCTGATGCCCAGCAGGGCCGCCAGGCTCTCCAGCTGAGCATCGAGCAGGCCCAGACTGTGGCAGAACAGGTGGAGATGAA
GGCGAAGGTGGTCCAGTCTGAGGTCAAGGCCGTCACAGCTCGCCACAAGAAGGCCCTGGAGGATCGGGAGTGTGAGCTGT
TGTGGAAGGTATGGCTACCTTTCTGCTGGTGAGCAACCTGCTTCTCTGGCTGTTCTGAACACAGAGTTACAAGGTTAACG
TTATAAGAGAGGCCTCCAGNTTGGATAGCTTGTTTNGATCTAATACTGTGTTAGAGATAGCCTTCTTAGTAGTGTGTTCC
CCCTCCCCCCTNAATACCCTTAAAATTAAATAAAAAACAA
Sequence Type mRNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114424135..114434184 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es