Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12248E7
Clone ID IST12248E7
Vector VICTR76
Project tigm

Sequence tag IST12248E7HMF1
Sequence
GTCATTATGATACATATTTTAATACATTTTGAAATAAAAATTGGCAGGTAAAGATTTTGGATTTAAAAGGGACCATCATA
TTTGAAAAGAAAACCTCCTGGAGCCTTGGAGGGCCCCAGTGATAAGAATAATACTGTGGTATGAGATATCCCGAGTCTCA
TCCTAACATGCTCAGTAGTTGGGCATTCTANCCCAGTCTACCCTGTAGTGGTCATAGGTTCTGCCAAGATCTCTGGGTCC
ATGTCCAGTTTGGAGGGTCCAACATTTCAGTGCTTTTTGAGTTTCTCATTTTTATAAAAAGTTATCTCATAAGGGAGTCA
GTCTTCACGTTGGGGCTTTCCCAGGGAAACTGTCATCACTGGTAACAAACTGTAACTTTAAAGGGCATGTTGTTGCTGTT
ATTGNTTTGNCTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI34798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110655008..110655428 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029502 (Golga3) NM_008146 golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI (curated);Acc:Golga3-001]


Sequence tag IST12248E7BBF1
Sequence
GTCATTATGATACATATTTTAATACATTTTGAAATAAAANTTGNCAGGTAAAGATTTTGGATTTAAAAGGGACCATCATA
TTTGAAAAGAAAACCTCCTGGAGCCTTGGAGGGCCCCAGTGATAAGAATAATACTGTGGTATGAGATATCCCNANNCNNA
TCCTAACATGCTCAGTANTTGGGCATTCTAGCCCAGTCTACCCTGTAGTGGTCATANGTTCTGCCAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI34798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110655008..110655239 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029502 (Golga3) NM_008146 golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI (curated);Acc:Golga3-001]

 
Come back to gene ENSMUSG00000029502


For any suggestions or comments, please send an email to unitrap@crg.es