Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10178F10
Clone ID IST10178F10
Vector VICTR76
Project tigm

Sequence tag IST10178F10BBF1
Sequence
CAGCAACCTGCACCATCACAGCGGTCACAGTCACACAGGCGCTCACACCTTTCCGTGGCTGGCCCTAGTTCTACCGGAGA
GCCATCCTGCCCACTGCCAGTTTGACATTACACTACGCTCTCTCACTCACATCAGCAGCTCTGTGGACCCAAAACCTGGG
CCTCCCTCATGCCCTACTTGTGCTTCACCANNNACATTTGCCACCTTTGGGACAGCAGTGAGCCCTCGGGCAGGCTCTCA
GGAGCGACATACATGGCTCTGCTTCTGCGGGACATTGAGGTTTTCACAAGGGCACTGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 65772793..65773095 297
NO GENE  


Sequence tag IST10178F10HMF2
Sequence
CTTTCTGAGGATTCTAGCTTTTGTCAAACACACAGGATAACCCCGCTGTACAGCCCGGCCTCAGCATCTCTCTGAAGCCC
CANAAGCCGGATGCATCCTCTGGAGCTGGAAGCTTAGCCGGGTGGGGCTTTGCTCTGGGGGGTCTTCCCCAGGTTTCCAG
AGCAGACCTCTGGGCGGTGCTGATCTCTAATCTTATCANTCAACGCCA
Sequence Type genomic DNA
Unitrap ID UNI14618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57009869..57010075 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es