Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14626D5
Clone ID IST14626D5
Vector VICTR74
Project tigm

Sequence tag IST14626D5HMR1
Sequence
TTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTCTTA
Sequence Type genomic DNA
Unitrap ID UNI28711 UNI29815 UNI34059 UNI34060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 177342481..177342526 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026527 (Rgs7) NM_011880 regulator of G protein signaling 7 Gene [Source:MGI Symbol;Acc:MGI:1346089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 28544956..28545001 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049109 (E430004N04Rik) NM_178666 RIKEN cDNA E430004N04 gene Gene [Source:MGI Symbol;Acc:MGI:2443552]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 19129409..19129454 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38379572..38379617 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16598082..16598127 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026748 (Plxdc2) NM_026162 plexin domain containing 2 Gene [Source:MGI (curated);Acc:Plxdc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 98323256..98323301 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96212206..96212251 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032411 (Tfdp2) NM_178667 transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]

 
Come back to gene ENSMUSG00000032411


For any suggestions or comments, please send an email to unitrap@crg.es