Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14484A9
Clone ID IST14484A9
Vector VICTR74
Project tigm

Sequence tag IST14484A9HMF2
Sequence
CCAGCAACNACATGGTGGCTCACAACCATCCGTAATGAGATCTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAATGTAC
TTACATATAATAAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81794328..81794458 129
NO GENE  


Sequence tag IST14484A9HMR1
Sequence
GCTGGGATTTGAACTCTGGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCN
Sequence Type genomic DNA
Unitrap ID UNI274 UNI477 UNI8718 UNI10238 UNI13375 UNI15268 UNI32318 UNI32380 UNI32381 UNI36098 UNI36099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9683056..9683113 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4681075..4681132 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3374554..3374611 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034587 (8430429K09Rik) RIKEN cDNA 8430429K09 gene Gene [Source:MGI Symbol;Acc:MGI:1918773]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3599478..3599535 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071454 (Dtnb) NM_007886 dystrobrevin, beta Gene [Source:MGI Symbol;Acc:MGI:1203728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3364550..3364607 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12776481..12776538 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8036004..8036061 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4893455..4893512 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022517 (Mgrn1) NP_083933 mahogunin, ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2447670]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3108970..3109027 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6171358..6171415 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3761997..3762054 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4816111..4816168 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026662 (Sephs1) NM_175400 selenophosphate synthetase 1 Gene [Source:MGI (curated);Acc:Sephs1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 14620655..14620712 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3437847..3437904 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5701724..5701781 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 28623704..28623761 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001424 (Snd1) NM_019776 staphylococcal nuclease and tudor domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1929266]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3371623..3371680 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4335378..4335435 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055951 (AC155164.5) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C938]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14632129..14632186 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031928 (Mre11a) NM_018736 meiotic recombination 11 homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Mre11a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 34724..34781 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079840 (Zfp131) NP_082521 zinc finger protein 131 Gene [Source:MGI Symbol;Acc:MGI:1919715]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 182285..182342 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 52334..52391 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079194 (AC133103.5-209) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UT50]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 15154..15211 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079303 (CAAA01120505.1.1.41101) NP_082521 Zinc finger protein 131 [Source:UniProtKB/Swiss-Prot;Acc:Q8K3J5]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166421: 556991..557048 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 11777441..11777498 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 578855..578912 58
NO GENE  


Sequence tag IST14484A9BBF1
Sequence
CCAGCAACCACATGGTGGCTCACAACCATCCGTAATGAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 118819227..118819272 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82953847..82953892 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148744628..148744673 46
NO GENE  

 
Come back to gene ENSMUSG00000079303


For any suggestions or comments, please send an email to unitrap@crg.es