Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST449380
Clone ID OST449380
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST449380
Sequence
GACTGAGGGATGAAGANGCCCCTTCTAGGTCCCAGNATGAAGAGGCCACCAAGCCTGAAGGCTGGCTAGACGACGAACCT
GAGTATATTCCAGACCCTGATGCAGAGAAGCCAGAGGATTGGGATGAGGATATGGACGGAGAATGGGAGGCTCCTCAGAT
TGCCAACCCCAAGTGTGAGTCAGCCCCTGGGTGTGGTGTCTGGCAGCGACCTATGATTGACAACCCCAATTATAAGGGCA
AATGGAAGCCTCCAATGATTGACAACCCTAACTACCAGGGAATCTGGAAACCAAGGAAAATACCAAATCCAGATTTCTTT
GAAGACCTAGAACCTTTTAAGATGACTCCTTTCAGTGCTATTGGTTTGGAGCTCTGGTCCATGACATCCGACATCTTTTT
TGACAACTTTATCATTAGTGGTGACCGAAGAGTAGTTGATGATTGGGCCAATGATGGGTGGGGCCTGAAGAAAGCTGCTG
ATGGGGGAGGAAGA
Sequence Type mRNA
Unitrap ID UNI10598

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50112639..50115375 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es