Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13776H2
Clone ID IST13776H2
Vector VICTR74
Project tigm

Sequence tag IST13776H2BBF1
Sequence
AACCTACCAGNGCAAGCAAGGCTGACCGGGGCAAGCAGAAGTTCTAAAAGTTCAGTTCCGGACAACCACATAAAGGCTCA
CAACCATCTGTACAGCTACAGTGTACTCACATACATAAGATAAATCTCTTTTTAAAATGTGCTAAGTTGCCGAAGTTCGA
AACTGTAAGCTTCAGCTGATGCTTTCGATTANCGGGGTCATTGTTGTCCTCTANAGCCTGCTTTTTCTTGTAAATCGCGG
ATGACTGGATGATTGTCTGGGATTAAGGTCACGGACTGCACAAGGCGTTTAGGGGTGGAGCCTTCCACTTGGATGCCTAC
CCGAAATAATAGTTGTTACCAGATGCCAGGCGTCCACTGCGGATTTANGGTCACTCCNAGTGTTGGATTGGTTGCTGAAC
CGCTAGGACTGTGCCNNANCCNNGNCCTAATCTGTGTCCTCANGTGGATTCCTAAACTGTCNNCCANTCNNAANCCNGAA
NGANGTGNGNTNNGNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13776H2HMF1
Sequence
AACCTACCAGAGCAAGCAAGGCTGACCGGGGCAAGCAGAAGTTCTAAAAGTTCAGTTCCGGACAACCACATAAAGGCTCA
CAACCATCTGTACAGCTACAGTGTACTCACATACATAANATAAATCTCTTTTTAAAATGTGCTAAGTTGCCGAAGTTCGA
AACTGTAAGCTTCAGCTGATGCTTTCNATTANCGGGGTCATTGTTGTCCTCTAAAGCCTGCTTTTTCTTGTAAATCGCGG
ATGACTGGATGATTGTCTGGGATTAAGGTCACGGACTGCACAAGGCGTTTAGGGGTGGANCCTTCCACTTGGATGCCTAC
CCGAAATAATAGTTGTTACCAAATGCCNGGCGTCCACTGCGGATTTAGGGTCACTCCAAGTGTTGGATTGGTTGCTGAAC
CGCTAGGACTGTGCCANANCCNTGGCCTAATCTGTGTCCTCAGGTGGATTCCTAAACTGTCCACCAGTCCTAAGCCGGAA
GGAGGTGGGGTCTGGATCCNCAGGGCTGGNNATTCGNCNNNTCTNANAN
Sequence Type genomic DNA
Unitrap ID UNI33041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29477508..29478023 490
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037463 (Fbxo27) NM_207238 F-box protein 27 Gene [Source:MGI (curated);Acc:Fbxo27-001]

 
Come back to gene ENSMUSG00000037463


For any suggestions or comments, please send an email to unitrap@crg.es