Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13600H11
Clone ID IST13600H11
Vector VICTR74
Project tigm

Sequence tag IST13600H11HMF1
Sequence
TTGAGGCAGGGGCATTACTGTGAATAAATTTCTAAGGCAGAGGCATAACTGTGAGTGATTTTCTGAGGCANTGGGATGAC
TGTGAGTGATTTTCTGAGGCAGGGGGATGACTGTTAGTGTGTTTTTGACGTAGGGGTTTGATGCTGANTGACNGNGTNNC
NCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 166438928..166439084 149
NO GENE  


Sequence tag IST13600H11BBF2
Sequence
TTCGGAAAAGAGGCACCAGCTACTCAAGGCCGGATCAACAGAAGTGGGCAGTAAAACAGTCACATGGTAAACTGCACGTG
CCAAAATAAGGCTGGGCTCTCANATCTTT
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20612800..20612904 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es