Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15053G3
Clone ID IST15053G3
Vector VICTR80
Project tigm

Sequence tag IST15053G3HMF1
Sequence
TTAGCAGTCAGATAAAGGCATGTCCTGCCTTTTGAAGCTTACCCAGGGATCTTTCCTTTGTTTGATTGGCCGACCTCACC
ACGGGAAGGCTCGCGCGAGTACGACTGCCTCTGGCGAAAGGACTCGGTACTTCTCCCTCGGACATGGCTTCCAAAGAGTC
ACCAGATGTCTCTGATAAATGTTCAACCGGATCCCCCAAATTGGGAGGTTGAGGACTGTGGGACAGCTTGGGACTTTTTG
TCTGCAAAAGATATTTTAAAAGAAANTGTTATTGCTACAAGAAAGAATTANTNATTATTTATTANTATGAATTTATTATN
NCCNTGATATTGNCNNTGCCANCTCTGGNCAGGNNNAANACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15053G3BBF1
Sequence
CAAGCAGTCAGATAAAGGCATGTCCTGCCTTTTGAAGCTTACCCAGGGATCTTTCCTTTGTTTGATTGGCCGACCTCACC
ACGGGAAGGCTCGCGCGAGTACGACTGCCTCTGGCGAAAGGACTCGGTACTTCTCCCTCGGACATGGCTTCCAAAGAGTC
ACCAGATGTCTCTGATAAATGTTCAACCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20583573..20583765 193
NO GENE  


Sequence tag IST15053G3HMR1
Sequence
GTACATGTTTTTATGCTTCTGAGCATTTGCCCTTGGACTCAGGTATCAGTTTAATCTTACTCTGCAACTGCTGACCCTAG
AAGACTTCGATGGTTTAATAGTGTGTTAGTTTTCCATCACTGACAGTTACCCTACATATTGTTGCATAAGGCAGAAAGAT
TTATTTTGGTTCACTGTTTTAAAGATTTTAGTCCATGTTTGCCTGGCTCTGTTGCTTCCCTTATGGGCCTGTGGGAAGAC
AGTAATTATGGAGGAGCAAAATGGCTCACTTCAGAGCAGGAAGGATGCTCTCGTTCCCTAATCTACTGTTTTATTCCTAT
GGGAGAACAGACATTATGATGGAGTATGTGGTAGTACAGAGCTATGGTTAGGATGAAGATAGGGAAAGGAAGGGCCAAGG
GTCTCCAGTTATCTTTCTTTCNTGTGGCTCCACTGTCCNNNGGTGCCNTCGCCTCCTAGAATTGGTGCAGGCTGGTAGAC
AAGTCCTTTACCCATAGGCCTTTGTGANGACTTTTAAGATCNNAANAAAATGAATATCNNGTTNNGCNGGANAATTTNAT
NNNCC
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20583765..20584324 528
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es