Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10843D5
Clone ID IST10843D5
Vector VICTR76
Project tigm

Sequence tag IST10843D5HMF1
Sequence
TTCCTANGTCANAGAAGGAAAGCTCTGTAAGCCCAGGGTCAGCANAAATCACTGCCATTTCTCTCTAGCTACTTGCCTTT
CGTCCAAGCCTTTTCCTGCTACCCCCCTCCCACAAAGTCCCCAGGCCCTGGCTCAACAGGCCGTCTCCTGGCCCTTGCCC
CTTATTCTCACAAGCTGCCGCAGGCTTCCCAAGGTGCTGATGTCTGGAGGCAGGGCTCCTAACTTGTTGTTGCTGATGAT
AANCACTCGAAGGGGCANCTGGCAGATGTAGGGTGGCAACGACNACAGCTGGTTCCGGCTGTGGAAGGGAGAAAGGCAGC
ANGCTTATNCCCNANGCAAAGCATCAAGCACCAGGCCTCCTNCTGGGTCTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138075005..138075373 347
NO GENE  


Sequence tag IST10843D5HMR1
Sequence
GGATGTGAGCAGCAATGAGCTGCAGTCCCTGCCCGTGGAGCTGTGTANCCTCCGTTCCCTGCGGGATCTCAATGTTCGAA
GGAACCAGCTCANTACNNNGCCTGANGGTNAGGAAAGTGAGCCAGAGGGCATGGTGTCTGTGCTCATCTGTGTCTTCATC
GGCTCGGCTGCAGTAACACATGTGTTGTACATACGCTGGGTGGCTTCTAAGCAGCACAGGCATTGCCCACAGTCANATCC
GGTGCTGTGTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI36103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138075371..138075626 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es