Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15004D11
Clone ID IST15004D11
Vector VICTR78
Project tigm

Sequence tag IST15004D11BBF1
Sequence
CTTGGACTGTTTTGTGCGGGTCAGGGCATCTTCTGGACCTCCCTGGCTGTTGCAGCCTTGTCCAGACCTCTGAGCCGAGT
ACCTGCGGAGGCTCCGAACCGGAGCTACCAGGACCTGCGCTCCGCACTCTGGCGCTACGGGCTGGCTGTTGGTTGCGGCA
CGATGGGTAAGCGCTTGGGCTCCANATTGCTGTGGGGCTGTGAGCACAACGCTCACTTANCAAAAAGGGGCTTCCNANNA
AGTAAGTGGGACACNCGATATGGGTGCGGTGTAATAAANTCCNNGANTGCN
Sequence Type genomic DNA
Unitrap ID UNI23383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8845640..8845929 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075043 (0610006I08Rik) NM_025791 RIKEN cDNA 0610006I08 gene Gene [Source:MGI Symbol;Acc:MGI:1914086]

 
Come back to gene ENSMUSG00000075043


For any suggestions or comments, please send an email to unitrap@crg.es