Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST449117
Clone ID OST449117
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST449117
Sequence
CATGGGCGTGCCTTCCCCTACGCCGANCTTGNCCTGNNCGCCAGGGNTGGCTNTACCANGGGCATNCGGCTTNGNCTNNN
NACNGCTNGATNCNGAAACAGAACGCCCNNGAANGNATTGGTATTGACCACGCGTCAGGCTCTGCCAGCACAGGAAACCA
CCNNNGCCGANCGGTNGNTCTGNAAACCAAGTACAGATGGACTGAGTNTGGGCTGACGTTTACAGAGAAGTGGAACACAG
ACAACACCCTGGGCACTGAGATCACTGTGGAAGACCAGCTTGCTCGTGGACTGAAGCTCACCTTTGATTCGTCATTCTCG
CCGAACACTGGGAAAAAAAATGCTAAAATCAAGACAGGGTACAAGAGGGAGCACATCAACCTCGGCTGTGACGNGGACTT
TGACATCGCTGGGCCCTCGATCCGGGGCGCTCTGGTGCTTGGCTATGAGGGTTGGCTGGCTGGCTACCANATGAATTTTG
AGACCTCGAAGTCCCGAGTGACCCAGAGCAACTTCGCAGTTGGCTATAAGATTC
Sequence Type mRNA
Unitrap ID UNI17103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52189892..52197551 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es