Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14754B9
Clone ID IST14754B9
Vector VICTR76
Project tigm

Sequence tag IST14754B9BBF1
Sequence
ATGCTACCTCCACATAACAGAAATTGGGACACCTGTTCTAGTGGTAGCCCTAGAGAAGACTCCAGAATCATGTCTGTCCA
CTAACTGTTGGTGCTGAGTTCCCAACAAGGAGAGCTGAGAGAAAGGAGGGCAAGTCCAGAGACACAATAAGCCTTCAGAG
GACTCCCAGCTCCGGGACTCAGCAGTTATAGTCTCAGCACTGACCGAAGTGTTTGCTGTTGTTACGCACAAAAAAATATC
TTCAAATACCCCATAGCCACTTCAAAACTGTTAGTTCANTTGCNCAANCTGTGTAAGANTCTGANGTAGTANCTCANGAG
ACTANGAAGTGTGANATTGCCTGCANCCCCTACAGTTAGGTCCACAGGCTACNTAANNAAACANTGNTTCNANNANNGAA
AAGTNNCTTTAAGANNTACCCNANNCNAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14754B9HMR1
Sequence
GCATGATTTGAATAGTGGTGTACACAGGAAAATTAAAAGGAGAAAGATGTCATAATTTGGCCTCATGCAGACTAAATTGT
CAAAAGTGGGGAAAAGCTGTCCTCTTCTCTTGGCTGAGGTACATCAAGTCTTGGTAGTTTTGCAGATCAGAGTTGTGTGA
GCATTTCTGAGCGATGGATCAGGTTTTCAGGATGCACTAGATGGGGCTGGGAGGCACTTGTCATTGATAATTAACCAAAG
TAAATGTTTATGGGAAGTGGTTANCANANCTTGCTTTTGAATTTGTGGTTAGGCTAGTGCNTTGCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI5233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122437981..122438289 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]


Sequence tag IST14754B9HMF1
Sequence
ATGCTACCTCCACATAACAGAAATTGGGACNCCTGTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122437947..122437984 36
NO GENE  

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es