Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12365F2
Clone ID IST12365F2
Vector VICTR76
Project tigm

Sequence tag IST12365F2HMF1
Sequence
AGCAGCAGCGGTCGCCATCTTGGTCCGGGACCCGCCGAACTTAGGAAATTAGTCTGAACAGGTGAGAGGGTGCGCCAGAN
AACCTGACAGCTTCTGGAACAGGCGGAAGCACAGAGGCGCTGAGGCAGCACCCTGCGTGGGCCGGGGACAGCCGGCCACC
TTCCGGACCAGAGGACAGGTGCCCACCCGGCTGGGGAGGCGGCCTAAGCCACAGCAGCAGCGGTCGCCATCTA
Sequence Type genomic DNA
Unitrap ID UNI23495 UNI31495 UNI36108 UNI36109

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 25719486..25719717 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 63186312..63186543 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060843 (Ctnna3) NM_177612 catenin (cadherin associated protein), alpha 3 Gene [Source:MGI (curated);Acc:Ctnna3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 41697768..41697999 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45584118..45584349 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020598 (Nrcam) NP_795904 neuron-glia-CAM-related cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:104750]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24120349..24120580 230
 
EST/CDNA Est Name
  AA000224.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20291274..20291505 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 14099432..14099663 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 41576220..41576451 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061080 (Lsamp) NM_175548 limbic system-associated membrane protein Gene [Source:MGI (curated);Acc:Lsamp-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 69673515..69673746 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22456152..22456383 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 49415325..49415556 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 64150788..64151019 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 73668186..73668417 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 91321546..91321777 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 17114462..17114693 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028780 (Sema3c) NM_013657 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C Gene [Source:MGI Symbol;Acc:MGI:107557]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19095511..19095742 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 80073026..80073257 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 66925005..66925236 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 87566199..87566430 230
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 41842578..41842809 230
NO GENE  

 
Come back to gene ENSMUSG00000028780


For any suggestions or comments, please send an email to unitrap@crg.es